Skip to main content

Table 2 Primers used in this study

From: The QseB/QseC two-component system contributes to virulence of Actinobacillus pleuropneumoniae by downregulating apf gene cluster transcription

Primers Sequence (5′-3′)a
For mutant construction
 qseBC-up-F/R TTGTCGACCTATGGCTTTAACTTCCTTCG
GGGAATTCATTATTGTCCGATAAAGCGAC
 qseBC-down-F/R GGGAATTCTTAAGCCGAAGAGAAAAAGACG
GGTCTAGAGTCGTATCGTTTAATGCGATC
 apfA-up-F/R CTGTCGACTTTGATACCGAGCTGCAATAAGCGT
GCGTTTACTTTAATTGAATTGATGAGGAAACGAAATGTAAAGGGGAGGAC
 apfA-down-F/R GTCCTCCCCTTTACATTTCGTTTCCTCATCAATTCAATTAAAGTAAACGC
ATGCGGCCGCCGCTACGGCTGAGGAAAATC
 apfB-up-F/R CTGTCGACCGATAATCAGCATTAAGATCGGCTC
GAAATACCTGCTCGGGCAATTAATATTGTTATCACGGCTACAGAGGC
 apfB-down-F/R GCCTCTGTAGCCGTGATAACAATATTAATTGCCCGAGCAGGTATTTC
ATGCGGCCGCTACATTCTTTGCATTGCCCCAT
 apfC-up-F/R CTGTCGACGGCTTGTATTTGGCTTAACATCTCT
ACAACTTCAGAAAGGAAAAGCGTATTATCGGTACGGTTTTGATCGGAT
 apfC-down-F/R ATCCGATCAAAACCGTACCGATAATACGCTTTTCCTTTCTGAAGTTGT
ATGCGGCCGCCGAGATTTTTGCTTTTCTTACGC
 apfD-up-F/R CTGTCGACCATTTGCTTTCCTTATCTTTTGCTA
GTGGTGTAAGCGAAGTATTCCTCAATTTTCGACTTTCGTGCTAATTATTG
 apfD-down-F/R CAATAATTAGCACGAAAGTCGAAAATTGAGGAATACTTCGCTTACACCAC
ATGCGGCCGCGCTGAATGATTTAAACCGTTTGATA
 apxIVA-F/R GGCTACCCATTTCCCTTCG
GAGCAACAACGTCGCACA
 qseBC-exterior-F/R GTTTATCGGTAGGTCCACAGG
TGATCGCAGCAAATACCAAA
 qseBC-interior-F/R CGGAACGACTCGCCTCTT
AAATCGCCAAAATCAATAGCGGTAG
 apfA-exterior-F/R AATACCGGCTCAATTCGCTTA
ACCAGTCACGTAAAGGGTCGGC
 apfA-interior-F/R GGTGTCATCGTATAACCGTATT
TTGGCGGCATCGGCTTCTT
 apfB-exterior-F/R GTTGGATACGGATCTGTGAATAG
TTACGGTGGAAGGCGGAACGATTAC
 apfB-interior-F/R CGCATCATTGGTATGTAAGGTC
GGATTTCCGTGTTTCGAGTTT
 apfC-exterior-F/R AGGAATACTTCGCTTACACCAC
GTTATCACGGCTACAGAGGC
 apfC-interior-F/R CTAATCGCCCGCTTTGTT
CTGAATGCCGCAGTCCCT
 apfD-exterior-F/R CATCATCGGCATAACGCAGTC
AGGCGGATTAGTCGGAGGC
 apfD-interior-F/R GCATAAACCCAGCATACCA
TTCCTCTGCTTGCCTTTG
For complement construction
 qseBC-F/R AACTGCAGTTGCAAAATTTCAGCAAATTTAGAC
TTGCGGCCGCTTAGAAGATAATTTCCGCTTTTAAA
 apfA-F/R CCCTCGAGATGCAAAAACTAAGTCTTATTCGAC
TTGCGGCCGCTTAATTTGATGCGCAGAAATTTGCC
 apfB-F/R CCCTCGAGATGCAGTATTCCGTATGTGATGTAA
TTGCGGCCGCTCATACACTTTCAACATGACCTAAC
 apfC-F/R CCCTCGAGATGTTGAAAGTGTATGAATTTCATT
TTGCGGCCGCCTAACCGCCTCCGACTAATCCGCCT
 apfD-F/R CCCTCGAGATGAGTTCTCCGATTTTCGCATGGT
TTGCGGCCGCTTAGATATAAATTTTATCAATAATT
For RT-qPCR
 16S rRNA-F/R CCATGCCGCGTGAATGA
TTCCTCGCTACCGAAAGAACTT
 apfA-qPCR-F/R GACCGCCGCTACAGTTTTTA
TTGCCATTTTAGCTACGGTTG
 apfB-qPCR-F/R CGAAGGCGCATCATTGGTAT
CAAACGCAAATAAACCCGGC
 apfC-qPCR-F/R AAATTTCGCCTAATCGCCCG
GCCGCAGTCCCTTTAAAACA
 apfD-qPCR-F/R TGTCCCCGCTTCCCAATATT
TGCTTGCCTTTGGAATTGCT
For protein expression
 PqseB-F/R CGCCCATATGTTGCAAAATTTCAGCAAATTTAGAC
CGCCCTCGAGAGCATCTGAATTTCCTATTTTA
For EMSAs
 apf-EMSA-F/R ATCCCTCTCCTTATCATATCTAAGA
TTTGACCTCTGAATTTATTAAAACG
 pilM-EMSA-F/R CGAAAAATTCTCTTCTGGTAAATGA
AATTTTAGTTCCTTAAATCAACTTT
 glpK-EMSA-F/R CGTTTCCCTTTTTTACGGACTAAAC
ATAGTCCTCCTACGGATAACGAAAA
  1. aRestricton sites are underlined