Isolation, purification, and identification of M. synoviae strains
The study was carried out from 2019 to 2021, during which 485 samples were taken from 5 to 25 week old chickens suspected of having M. synoviae infection in the farms based on clinical symptoms of air sacculitis, chest cyst, footpads and joint swelling. We collected samples from the footpads and joints in this study.
For isolation of M. synoviae, chicken feet were wiped repeatedly with alcohol-soaked cotton swabs and dried before aseptic collection of joint fluid and the contents of the swollen tarsal joint cavity in a biologically clean safety cabinet. The samples were then placed into 3 mL Mycoplasma medium (pH 7.8) [Modified Frey Medium Base (Chinese Veterinary Pharmacopoeia) with 15% porcine serum, 1% glucose, 1% 100 mg/L L-cysteine, 3% 400 mg/L L-arginine, 1% 100 mg/L β-nicotinamide adenine dinucleotide trihydrate (β-NAD), 0.1% 100 mg/mL ampicillin (Amp), and 0.02% phenol red] and cultured at 37°C in a 5% CO2 incubator (Thermo Fisher Scientific, USA). When the medium became yellow, the isolates were transferred to fresh medium. After three passages, 100 μL liquid culture was plated onto Mycoplasma solid medium (Mycoplasma medium + 1.5% Agar) and cultured at 37°C in a 5% CO2 incubator. Colony growths with a characteristic “fried egg-like” bulge in the center were observed under a low-power microscope after about 7 days. Bacteria from single colonies were selected and cultured in liquid medium.
At the third passage in liquid medium, the strains were identified by PCR and sequenced using 16S rDNA primers. To amplify the conservative region of M. synoviae vlhA gene (accession no. AF035624.1), a pair of specific primers (F: 5′–TTAGCAGCTAGTGCAGTGGCC–3′; R: 5′–GTAACCGATCCGCTTAATGC–3′) were designed using Primer Premier 5.0 software. The 16S rDNA primers (Karita et al. 2003) (27F: 5′–AGAGTTTGATCCTGGCTCAG–3′; 1492R: 5′–GGTTACCTTGTTACGACTT–3′) were synthesized by Shenggong Biotechnology Co., Ltd. (Shanghai, China).
The 50 μL reaction mixture consisted of 25 μL 2× Taq Master Mix (Vazyme Biotechnology Co., Ltd. Nanjing, China), 2 μL forward primer (10 μM), 2 μL reverse primer (10 μM), 2 μL sample culture, and 19 μL sterile ddH2O. Amplification was performed on a PCR instrument (Bio-Rad, Hercules, CA, USA) with the following thermal cycling conditions: 94°C for 5 min, then 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C (depending on primers) for 2 min (16S rDNA) or 30 s (vlhA gene).
M. gallisepticum and E. coli strains stored in the laboratory and sterile ddH2O were used as negative controls for the specificity test. DNA was extracted from isolates using the TIANamp Bacteria DNA Kit DP302 (Tiangen Biotech Co., Ltd., Beijing, China), 10-fold serial diluted to 10-10, then used to perform PCR amplification according to the above conditions and evaluate the susceptibility.
Amplified DNA products were separated on a 1.5% agarose gel in tris-acetic acid-ethylene diamine tetraacetic acid (EDTA-TAE) buffer (40 mM Tris, 40 mM acetic acid, 1 mM EDTA, pH 8.3) for 30 min at a constant voltage of 110 V. Amplified products were detected with a gel imaging system (Bio-Rad). The amplified 16S rDNA products were sequenced by Tsingke Biotechnology Co., Ltd. (Beijing, China). Sequencing results were compared with BLAST software on the NCBI website.
Growth titration of isolates – color change units
The growth titers (in CCUs) of isolated strains were determined using the microdilution technique. Briefly, 200 μL liquid medium was added to the 12th well of each row in a 96-well plate, and 180 μL was added to wells 1–11 of each row. Subsequently, 20 μL bacterial solution was added into the 1st well and used to prepare 10-fold serial dilutions to the 11th well. The 1st well was set up as the positive control (180 μL medium + 20 μL bacterial solution), and the 12th well as the negative control (200 μL medium). The plate was sealed with parafilm (PM-996 Parafilm, USA) and incubated at 37°C in a 5% CO2 incubator for approximately 2 weeks. Three repetitions were prepared for each experiment. The concentration of the last well of test wells 1–11 showing yellow color was identified as the CCU of the strain and deemed to be the titer of the strain (CCU/mL).
Antibiotics
The following eight antibiotics from five different groups were purchased from Hvsen Biotechnology Co., Ltd. (Wuhan, China). The macrolides tylvalosin (lot number 201903024), tylosin (lot number AEC80138KM), and tilmicosin (lot number TMC1908048); the pleuromutilin tiamulin (lot number 01971807063); the fluoroquinolone enrofloxacin (lot number 190107-4); the lincosamide lincomycin (lot number 190322097); and the tetracyclines doxycycline (lot number YD190401097) and chlortetracycline (lot number S1906003). For each antibiotic, a stock solution was prepared using the appropriate solvents and diluents following the manufacturer’s instructions. The antibiotic solutions were diluted to 64 μg/mL and passed through a 0.22 μm membrane filter to sterilize the diluted solution. Antibiotics were tested in the concentration range of 0.0625–32 μg/mL.
Minimum inhibitory concentration for M. synoviae
The MIC for the isolated strains was determined using the microdilution technique based on the guidelines of Hannan (2000). Briefly, 200 μL liquid medium was added to the 12th well of each row in a 96-well plate, and 100 μL was added to wells 1–11 of each row. After dilution to 64 μg/mL with liquid medium, 100 μL diluted antibiotic was added in the 1st well and used to prepare 2-fold serial dilutions to the 10th well. Subsequently, 100 μL bacterial solution diluted to 105 CCU/mL was added to wells 1–11. The 11th well was set up as the positive control (100 μL medium + 100 μL bacterial solution), and the 12th well as the negative control (200 μL medium). The plate was sealed with parafilm (PM-996 Parafilm, USA) and incubated at 37°C in a 5% CO2 incubator for about 10 days. Three repetitions were set up for each experiment. After the yellow color was observed in the positive-control well, the concentration of the first well with no color change in test wells 1–10 was defined as MIC of the antibiotic for each strain.
The lowest concentration of antibiotic that completely inhibited the growth or metabolism of the isolate in vitro was considered to be the MIC value of the tested antibiotic. MIC50 and MIC90 were taken as the MIC of the antibiotic on 50% and 90% bacterial isolation.
When the highest antibiotic concentration did not inhibit growth, MIC value indicated that it was greater than (>) the highest antibiotic concentration in the plate. Conversely, if the minimum antibiotic concentration present in the plate inhibited growth, the MIC value was expressed as being lower than or equal to (≤) that concentration.
Evaluation of antibiotic treatment effects
Specific pathogen-free chickens (n = 240 aged 1 day) were randomly divided into the following groups (n = 20 per group): blank control (uninfected), infection control, tylvalosin low-dose (50 mg/L), tylvalosin medium-dose (100 mg/L), tylvalosin high-dose (200 mg/L), tylosin (200 mg/L), tilmicosin (200 mg/L), lincomycin (200 mg/L), doxycycline (200 mg/L), tiamulin (200 mg/L), and enrofloxacin (200 mg/L) groups. On day 14, chickens in the 10 treatment groups and infection control group were inoculated with 0.1 mL 106 CCU/mL of the MS-HB1 strain via the intranasal route. The blank control group was inoculated with sterile PBS.
Tracheal samples were collected 14 days after infection (1 day before medication). The 10 experimental groups of chickens were then treated with the corresponding doses of drugs, which were provided in their drinking water continuously for 5 days. Tracheal samples were collected 1, 7 and 14 days after drug withdrawal. DNA was extracted from samples using the TIANamp Bacteria DNA Kit DP302 (Tiangen Biotech Co.). The numbers of M. synoviae-positive chickens based on PCR amplification in the different antibiotic groups were compared according to the protocol described for identification of M. synoviae strains. The therapeutic effects were expressed as the number and percentage of M. synoviae-positive and M. synoviae-negative chickens.
Evaluation of the ability of tylvalosin and tiamulin to block vertical transmission of M. synoviae
Chicken embryos (n = 120 at the 5-day stage) were randomly divided into six groups (n = 20 per group): 0.4 μg/mL (5 MIC) tylvalosin group, 0.08 μg/mL (1 MIC) tylvalosin group, 0.4 μg/mL tiamulin group, 0.08 μg/mL tiamulin group, M. synoviae control group, and blank control group. With the exception of the blank control group, all groups were inoculated with 104 CCU/0.1 mL of the MS-HB1 strain through the yolk sac. Three days after infection, the four experimental groups were inoculated with 100 μL drugs of corresponding doses. Each group was placed in a 37°C incubator. On the third and fifth days of treatment, 10 chicken embryos were selected from each of the experimental and control groups before the extraction of the whole vitelline membrane. These samples were inoculated into 5 mL liquid medium and incubated at 37°C under 5% CO2. After 3 days, the vitelline membrane culture was centrifuged at 8000 rpm for 5 min, then 100 μL supernatant was added to 900 μL fresh liquid medium, and the culture was continued at 37°C under 5% CO2. After 3 days, the inhibitory effect of the drug on M. synoviae in chicken embryos was assessed according to PCR identification. Results were expressed as number and percentage of M. synoviae-positive and M. synoviae-negative chickens.
Statistical analysis
All the derived data were evaluated for normal distribution before statistical analyses. All statistical analyses were performed using Fisher’s exact test within SPSS 23.0 software. P < 0.05 and P < 0.01 were set as the threshold for statistical significance. The asterisks in the figures indicate significant differences (*P < 0.05; ** P < 0.01).
